Skip to main content

pET21a.MJ1228
(Plasmid #11410)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 11410 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET21a
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 5443
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    eukaryotic translation initiation factor
  • Species
    M. jannaschii
  • Insert Size (bp)
    396
  • GenBank ID
    MJ1228 AAB99231

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Proc. Natl. Acad. Sciences. 1998. 95:10419-10424.

Please note that the plasmid pET21a.MJ1228 contains an Ampicillin resistance marker, and the BL21 bacterial strain contains a plasmid, pSJS1244, that confers spectinomycin resistance and allows for expression of genes with rare codons.

Addgene provides this plasmid in the DH5alpha bacterial strain. For expression, please use BL21(DE3).Star/pSJS1244

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET21a.MJ1228 was a gift from Sung-Hou Kim (Addgene plasmid # 11410 ; http://n2t.net/addgene:11410 ; RRID:Addgene_11410)
  • For your References section:

    Cloning, expression, and crystallization of a hyperthermophilic protein that is homologous to the eukaryotic translation initiation factor, eIF5A. Kim KK, Yokota H, Kim R, Kim SH. Protein Sci. 1997 Oct . 6(10):2268-70. 10.1002/pro.5560061023 PubMed 9336851