pET21a.MJ1228
(Plasmid
#11410)
-
Depositing Lab
-
Publication
-
Sequence Information
-
Please contact us if you would like Addgene to sequence a portion of this plasmid before you request it.
-
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 11410 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET21a
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5443
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameeukaryotic translation initiation factor
-
SpeciesM. jannaschii
-
Insert Size (bp)396
-
GenBank IDMJ1228 AAB99231
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Proc. Natl. Acad. Sciences. 1998. 95:10419-10424.
Please note that the plasmid pET21a.MJ1228 contains an Ampicillin resistance marker, and the BL21 bacterial strain contains a plasmid, pSJS1244, that confers spectinomycin resistance and allows for expression of genes with rare codons.
Addgene provides this plasmid in the DH5alpha bacterial strain. For expression, please use BL21(DE3).Star/pSJS1244
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET21a.MJ1228 was a gift from Sung-Hou Kim (Addgene plasmid # 11410 ; http://n2t.net/addgene:11410 ; RRID:Addgene_11410) -
For your References section:
Cloning, expression, and crystallization of a hyperthermophilic protein that is homologous to the eukaryotic translation initiation factor, eIF5A. Kim KK, Yokota H, Kim R, Kim SH. Protein Sci. 1997 Oct . 6(10):2268-70. 10.1002/pro.5560061023 PubMed 9336851