Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pStA1BZ
(Plasmid #114164)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 114164 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Tetracycline, 10 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    None

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer OligoGT339 GTTGAGGACCCGGCTAGG
  • 3′ sequencing primer OligoGT340 TGTGACGGAAGATCACTTCG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Accession Number MG649424 , Alternative ID = pGT403 . Please visit https://www.biorxiv.org/content/early/2018/07/04/361626 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pStA1BZ was a gift from John Heap (Addgene plasmid # 114164 ; http://n2t.net/addgene:114164 ; RRID:Addgene_114164)
  • For your References section:

    Start-Stop Assembly: a functionally scarless DNA assembly system optimized for metabolic engineering. Taylor GM, Mordaka PM, Heap JT. Nucleic Acids Res. 2018 Nov 20. pii: 5193345. doi: 10.1093/nar/gky1182. 10.1093/nar/gky1182 PubMed 30462270