This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pcDNA3.1-Beta2-PAmcherry1
(Plasmid #114190)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 114190 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pcDNA3.1
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5424
  • Modifications to backbone
    β2-pamCherry1 was generated by replacing mEos2 in the β2-mEos2 construct by pamCherry1 using the XhoI and ApaI restriction sites. The primers ATCCGC- GAACTCGAGATGGTCAGCAAGGGCGAG (sense) and AGGTCCGAGGGCCCCTTACTTGTACAGCTCGTC (antisense) were used to generate a XhoI and ApaI sites in the pamCherry1 insert by PCR.
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Adrenergic receptor beta 2
  • Alt name
    Beta2
  • Alt name
    ADRB2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1326
  • Entrez Gene
    ADRB2 (a.k.a. ADRB2R, ADRBR, B2AR, BAR, BETA2AR)
  • Promoter SV40
  • Tags / Fusion Proteins
    • FLAG (N terminal on backbone)
    • 3HA (N terminal on insert)
    • PAmcherry1 (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site ApaI (not destroyed)
  • 5′ sequencing primer unknown
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1-Beta2-PAmcherry1 was a gift from Aleksandra Radenovic (Addgene plasmid # 114190 ; http://n2t.net/addgene:114190 ; RRID:Addgene_114190)