pSKB3.MPN625
(Plasmid
#11430)
-
Depositing Lab
-
Publication
-
Sequence Information
-
Please contact us if you would like Addgene to sequence a portion of this plasmid before you request it.
-
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 11430 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSKB3
- Backbone size w/o insert (bp) 5386
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameperoxiredoxin
-
Alt namestress inducible protein
-
SpeciesM. pneumoniae
-
Insert Size (bp)423
-
GenBank IDAAB95865 NP_110314 MPN625
-
Entrez GeneMPN625 (a.k.a. C12_orf141)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that the plasmid pSKB3.MPN625 contains a Kanamycin resistance marker, and the BL21 bacterial strain contains a plasmid, pSJS1244, that confers spectinomycin resistance and allows for expression of genes with rare codons.
Addgene provides this plasmid in the DH5alpha bacterial strain. For expression, please use BL21(DE3).Star/pSJS1244
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSKB3.MPN625 was a gift from Sung-Hou Kim (Addgene plasmid # 11430 ; http://n2t.net/addgene:11430 ; RRID:Addgene_11430) -
For your References section:
Crystal structure of a stress inducible protein from Mycoplasma pneumoniae at 2.85 A resolution. Choi IG, Shin DH, Brandsen J, Jancarik J, Busso D, Yokota H, Kim R, Kim SH. J Struct Funct Genomics. 2003 . 4(1):31-4. 10.1023/A:1024625122089 PubMed 12943365