pSKB3.EG10680
(Plasmid
#11436)
-
Depositing Lab
-
Sequence Information
-
Please contact us if you would like Addgene to sequence a portion of this plasmid before you request it.
-
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 11436 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSKB3
- Backbone size w/o insert (bp) 5386
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameOsmC
-
SpeciesE. coli
-
Insert Size (bp)429
-
GenBank IDAAC74555 NP_415999 EG10680
-
Entrez GeneosmC (a.k.a. ECK1476, JW1477)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that the plasmid pSKB3.EG10680 contains a Kanamycin resistance marker, and the BL21 bacterial strain contains a plasmid, pSJS1244, that confers spectinomycin resistance and allows for expression of genes with rare codons.
Addgene provides this plasmid in the DH5alpha bacterial strain. For expression, please use BL21(DE3).Star/pSJS1244
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSKB3.EG10680 was a gift from Sung-Hou Kim (Addgene plasmid # 11436 ; http://n2t.net/addgene:11436 ; RRID:Addgene_11436) -
For your References section:
Structure of OsmC from Escherichia coli: a salt-shock-induced protein. Shin DH, Choi IG, Busso D, Jancarik J, Yokota H, Kim R, Kim SH. Acta Crystallogr D Biol Crystallogr. 2004 May . 60(Pt 5):903-11. 10.1107/S0907444904005013 PubMed 15103136