Skip to main content

scADGFP
(Plasmid #114434)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 114434 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLVUTH
  • Backbone size w/o insert (bp) 4266
  • Total vector size (bp) 6578
  • Modifications to backbone
    Lentiviral LTRs replaced with AAV ITRs and deletion of 5' CMV promoter
  • Vector type
    Mammalian Expression, AAV
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Green fluorescent protein
  • Alt name
    eGFP-ERX
  • Species
    Synthetic
  • Insert Size (bp)
    743
  • Promoter Novel synthetic activity-dependent promoter
  • Tag / Fusion Protein
    • ER export sequence FCYENEV (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PacI (not destroyed)
  • 3′ cloning site AgeI (destroyed during cloning)
  • 5′ sequencing primer AAGGGCGACACGGAAATG
  • 3′ sequencing primer TCCGCCTCAGAAGCCATAGA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    scADGFP was a gift from Edward Perez-Reyes (Addgene plasmid # 114434 ; http://n2t.net/addgene:114434 ; RRID:Addgene_114434)
  • For your References section:

    EpiPro, a Novel, Synthetic, Activity-Regulated Promoter That Targets Hyperactive Neurons in Epilepsy for Gene Therapy Applications. Burke CT, Vitko I, Straub J, Nylund EO, Gawda A, Blair K, Sullivan KA, Ergun L, Ottolini M, Patel MK, Perez-Reyes E. Int J Mol Sci. 2023 Sep 23;24(19):14467. doi: 10.3390/ijms241914467. 10.3390/ijms241914467 PubMed 37833914