pLKO.TRC1.shmNsd1.1, puro
(Plasmid
#114446)
-
PurposeLentiviral vector for expression of shRNA sequence targeting mouse Nsd1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 114446 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepLKO TRC1
-
Backbone manufacturerSigma aldrich
-
Vector typeLentiviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameshNsd1.1
-
gRNA/shRNA sequenceGCTCGTTAAGACACCAGGAAA
-
SpeciesM. musculus (mouse)
-
Entrez GeneNsd1 (a.k.a. AI528500, KMT3B)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO.TRC1.shmNsd1.1, puro was a gift from Adrian Bracken (Addgene plasmid # 114446 ; http://n2t.net/addgene:114446 ; RRID:Addgene_114446) -
For your References section:
The H3K36me2 Methyltransferase Nsd1 Demarcates PRC2-Mediated H3K27me2 and H3K27me3 Domains in Embryonic Stem Cells. Streubel G, Watson A, Jammula SG, Scelfo A, Fitzpatrick DJ, Oliviero G, McCole R, Conway E, Glancy E, Negri GL, Dillon E, Wynne K, Pasini D, Krogan NJ, Bracken AP, Cagney G. Mol Cell. 2018 Apr 19;70(2):371-379.e5. doi: 10.1016/j.molcel.2018.02.027. Epub 2018 Mar 29. 10.1016/j.molcel.2018.02.027 PubMed 29606589