pIAGO-pegA + aceS
(Plasmid
#114457)
-
PurposeExpression of PegA and AceS in streptomycetes
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 114457 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepIAGO
-
Vector typeBacterial Expression
-
Selectable markersThiostrepton for streptomycete hosts
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepegA + aceS
- Promoter ermE
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (destroyed during cloning)
- 3′ cloning site Unknown (unknown if destroyed)
- 5′ sequencing primer 5_ ATGCGAGTGTCCGTTCGAGTG 3_
- 3′ sequencing primer 5_ GTTAGCTCACTCATTAGGCAC 3_ (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
A HindIII fragment containing the aceS gene was inerted into the HindIII site of plasmid pIAGO-pegAI. The glycosyltransferase and methylase genes are in the same orientation.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pIAGO-pegA + aceS was a gift from Patrick Caffrey (Addgene plasmid # 114457 ; http://n2t.net/addgene:114457 ; RRID:Addgene_114457) -
For your References section:
New insights into polyene macrolide biosynthesis in Couchioplanes caeruleus. Sheehan J, Murphy CD, Caffrey P. Mol Biosyst. 2017 May 2;13(5):866-873. doi: 10.1039/c7mb00112f. 10.1039/c7mb00112f PubMed 28383583