pET28-MetN
(Plasmid
#114458)
-
PurposeExpression of hexahistidine-tagged AceS methylase in E. coli
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 114458 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepET28
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameaceS
- Promoter T7
-
Tag
/ Fusion Protein
- Hexahistidine (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer T7 promoter primer: TTAATACGACTCACTATAGGG
- 3′ sequencing primer T7 terminator primer: GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET28-MetN was a gift from Patrick Caffrey (Addgene plasmid # 114458 ; http://n2t.net/addgene:114458 ; RRID:Addgene_114458) -
For your References section:
New insights into polyene macrolide biosynthesis in Couchioplanes caeruleus. Sheehan J, Murphy CD, Caffrey P. Mol Biosyst. 2017 May 2;13(5):866-873. doi: 10.1039/c7mb00112f. 10.1039/c7mb00112f PubMed 28383583