Skip to main content
Addgene

pIAGO-AceF1
(Plasmid #114461)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 114461 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pIAGO
  • Vector type
    Bacterial Expression
  • Selectable markers
    Thiostrepton for streptomycete hosts

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    AceDI + AceDII + AceN + AceM
  • Promoter ermE

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Pst I (not destroyed)
  • 3′ cloning site HinDIII (not destroyed)
  • 5′ sequencing primer 5_ ATGCGAGTGTCCGTTCGAGTG 3_
  • 3′ sequencing primer 5_ GTTAGCTCACTCATTAGGCAC 3_
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pIAGO-AceF1 was a gift from Patrick Caffrey (Addgene plasmid # 114461 ; http://n2t.net/addgene:114461 ; RRID:Addgene_114461)
  • For your References section:

    Versatility of enzymes catalyzing late steps in polyene 67-121C biosynthesis. Stephens N, Rawlings B, Caffrey P. Biosci Biotechnol Biochem. 2013;77(4):880-3. doi: 10.1271/bbb.120961. Epub 2013 Apr 7. 10.1271/bbb.120961 PubMed 23563553