Skip to main content

pgex6p-1mciap1
(Plasmid #11465)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 11465 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGEX6p-1
  • Backbone manufacturer
    amersham
  • Backbone size w/o insert (bp) 6600
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mciap1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1700
  • Entrez Gene
    Birc2 (a.k.a. A, AW146227, Api1, Api2, Birc3, C-IAP1, C330006D17Rik, HI, HIAP1, HIAP2, I, IAP1, IAP2, MI, MIAP1, MIAP2, MIH, MIHB, MIHC, RNF48, cI, cIA, cIAP1, cIAP2, mcI, mcIAP1)
  • Tag / Fusion Protein
    • GST (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer GGGCTGGCAAGCCACGTTTGGTGG
  • 3′ sequencing primer TCCGGGAGCTGCATGTGTCAGAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pgex6p-1mciap1 was a gift from Jon Ashwell (Addgene plasmid # 11465 ; http://n2t.net/addgene:11465 ; RRID:Addgene_11465)
  • For your References section:

    Posttranscriptional downregulation of c-IAP2 by the ubiquitin protein ligase c-IAP1 in vivo. Conze DB, Albert L, Ferrick DA, Goeddel DV, Yeh WC, Mak T, Ashwell JD. Mol Cell Biol. 2005 Apr . 25(8):3348-56. 10.1128/MCB.25.8.3348-3356.2005 PubMed 15798218