Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

mOtop3_pGEMHE
(Plasmid #114676)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 114676 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pGEMHE
  • Backbone size w/o insert (bp) 3019
  • Total vector size (bp) 4753
  • Vector type
    For generating the mRNA, which can highly express in Xenopus laevis oocytes

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Otopetrin 3
  • Alt name
    Otop3
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1734
  • GenBank ID
    NM_001347647
  • Entrez Gene
    Otop3 (a.k.a. 2310011E08Rik)
  • Promoter T7

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer taatacgactcactataggg
  • 3′ sequencing primer TTAGGAGCAGATACGAATGGCTAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mOtop3_pGEMHE was a gift from Emily Liman (Addgene plasmid # 114676 ; http://n2t.net/addgene:114676 ; RRID:Addgene_114676)
  • For your References section:

    An evolutionarily conserved gene family encodes proton-selective ion channels. Tu YH, Cooper AJ, Teng B, Chang RB, Artiga DJ, Turner HN, Mulhall EM, Ye W, Smith AD, Liman ER. Science. 2018 Mar 2;359(6379):1047-1050. doi: 10.1126/science.aao3264. Epub 2018 Jan 25. 10.1126/science.aao3264 PubMed 29371428