Skip to main content
Addgene

pLIC.B3.TM1734
(Plasmid #11527)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 11527 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLIC.B3
  • Backbone size w/o insert (bp) 6194
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PhoU
  • Species
    T. maritima
  • Insert Size (bp)
    705
  • GenBank ID
    AAD36799 TM1734 NP_229532
  • Entrez Gene
    TM1734 (a.k.a. TM1734)
  • Tag / Fusion Protein
    • HisTag, TEV cleavable (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SmaI (destroyed during cloning)
  • 3′ cloning site SmaI (destroyed during cloning)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GTTGCATCACCTTCACCCTCTCC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that the plasmid pLIC.B3.TM1734 contains an Ampicillin resistance marker, and the BL21 bacterial strain contains a plasmid, pSJS1244, that confers spectinomycin resistance and allows for expression of genes with rare codons.

Addgene provides this plasmid in the DH5alpha bacterial strain. For expression, please use BL21(DE3).Star/pSJS1244

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLIC.B3.TM1734 was a gift from Sung-Hou Kim (Addgene plasmid # 11527 ; http://n2t.net/addgene:11527 ; RRID:Addgene_11527)
  • For your References section:

    Crystal structure of a PhoU protein homologue: a new class of metalloprotein containing multinuclear iron clusters. Liu J, Lou Y, Yokota H, Adams PD, Kim R, Kim SH. J Biol Chem. 2005 Apr 22. 280(16):15960-6. 10.1074/jbc.M414117200 PubMed 15716271