-
PurposeExpresses human GATA3 in mammalian cells
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 115271 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCDNA3.1 (+)
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5428
- Total vector size (bp) 6700
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGATA3
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1334
-
Entrez GeneGATA3 (a.k.a. HDR, HDRS)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer GCAAATGGGCGGTAGGCGT (CMV-F)
- 3′ sequencing primer TAGAAGGCACAGTCGAGGCT (pCDNA3.1-R) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid was created in the “Molecular Genetics of Oral Inflammatory Diseases” lab directed by Arne S. Schaefer at the Charite Universitaetsmedizin Berlin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GATA3-pCDNA3.1 was a gift from Arne S. Schaefer (Addgene plasmid # 115271 ; http://n2t.net/addgene:115271 ; RRID:Addgene_115271)