Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

GATA3-pCDNA3.1
(Plasmid #115271)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 115271 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCDNA3.1 (+)
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5428
  • Total vector size (bp) 6700
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GATA3
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1334
  • Entrez Gene
    GATA3 (a.k.a. HDR, HDRS)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer GCAAATGGGCGGTAGGCGT (CMV-F)
  • 3′ sequencing primer TAGAAGGCACAGTCGAGGCT (pCDNA3.1-R)
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid was created in the “Molecular Genetics of Oral Inflammatory Diseases” lab directed by Arne S. Schaefer at the Charite Universitaetsmedizin Berlin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    GATA3-pCDNA3.1 was a gift from Arne S. Schaefer (Addgene plasmid # 115271 ; http://n2t.net/addgene:115271 ; RRID:Addgene_115271)