pLIC.B3.MJ0130m
(Plasmid
#11528)
-
Depositing Lab
-
Sequence Information
-
Please contact us if you would like Addgene to sequence a portion of this plasmid before you request it.
-
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 11528 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLIC.B3
- Backbone size w/o insert (bp) 6194
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameType I restriction-modification enzyme
-
SpeciesM. jannaschii
-
Insert Size (bp)1275
-
GenBank IDNP_247095
-
Entrez GeneMJ_0130m
-
Tag
/ Fusion Protein
- HisTag, TEV cleavable (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SmaI (destroyed during cloning)
- 3′ cloning site SmaI (destroyed during cloning)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GTTGCATCACCTTCACCCTCTCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that the plasmid pLIC.B3.MJ0130m contains an Ampicillin resistance marker, and the BL21 bacterial strain contains a plasmid, pSJS1244, that confers spectinomycin resistance and allows for expression of genes with rare codons.
Addgene provides this plasmid in the DH5alpha bacterial strain. For expression, please use BL21(DE3).Star/pSJS1244
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLIC.B3.MJ0130m was a gift from Sung-Hou Kim (Addgene plasmid # 11528 ; http://n2t.net/addgene:11528 ; RRID:Addgene_11528) -
For your References section:
Crystal structure of DNA sequence specificity subunit of a type I restriction-modification enzyme and its functional implications. Kim JS, DeGiovanni A, Jancarik J, Adams PD, Yokota H, Kim R, Kim SH. Proc Natl Acad Sci U S A. 2005 Mar 1. 102(9):3248-53. 10.1073/pnas.0409851102 PubMed 15728358