Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pLIC.B3.MJ0130m
(Plasmid #11528)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 11528 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLIC.B3
  • Backbone size w/o insert (bp) 6194
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Type I restriction-modification enzyme
  • Species
    M. jannaschii
  • Insert Size (bp)
    1275
  • GenBank ID
    NP_247095
  • Entrez Gene
    MJ_0130m
  • Tag / Fusion Protein
    • HisTag, TEV cleavable (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SmaI (destroyed during cloning)
  • 3′ cloning site SmaI (destroyed during cloning)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GTTGCATCACCTTCACCCTCTCC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that the plasmid pLIC.B3.MJ0130m contains an Ampicillin resistance marker, and the BL21 bacterial strain contains a plasmid, pSJS1244, that confers spectinomycin resistance and allows for expression of genes with rare codons.

Addgene provides this plasmid in the DH5alpha bacterial strain. For expression, please use BL21(DE3).Star/pSJS1244

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLIC.B3.MJ0130m was a gift from Sung-Hou Kim (Addgene plasmid # 11528 ; http://n2t.net/addgene:11528 ; RRID:Addgene_11528)
  • For your References section:

    Crystal structure of DNA sequence specificity subunit of a type I restriction-modification enzyme and its functional implications. Kim JS, DeGiovanni A, Jancarik J, Adams PD, Yokota H, Kim R, Kim SH. Proc Natl Acad Sci U S A. 2005 Mar 1. 102(9):3248-53. 10.1073/pnas.0409851102 PubMed 15728358