This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #11532)


Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 11532 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    YjeQ GDP binding protein
  • Alt name
  • Species
    T. maritima
  • Insert Size (bp)
  • GenBank ID
    AAD36783 TM1717 NP_229516
  • Entrez Gene
  • Tag / Fusion Protein
    • HisTag-MBP, TEV cleavable (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SmaI (destroyed during cloning)
  • 3′ cloning site SmaI (destroyed during cloning)
  • 5′ sequencing primer CGTCAGACTGTCGATGAAGCCC
  • 3′ sequencing primer GTTGCATCACCTTCACCCTCTCC
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses

Depositor Comments

Please note that the plasmid pLIC.B4.TM1717 contains an Ampicillin resistance marker, and the BL21 bacterial strain contains a plasmid, pSJS1244, that confers spectinomycin resistance and allows for expression of genes with rare codons.

Addgene provides this plasmid in the DH5alpha bacterial strain. For expression, please use BL21(DE3).Star/pSJS1244

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLIC.B4.TM1717 was a gift from Sung-Hou Kim (Addgene plasmid # 11532)
  • For your References section:

    Crystal structure of YjeQ from Thermotoga maritima contains a circularly permuted GTPase domain. Shin DH, Lou Y, Jancarik J, Yokota H, Kim R, Kim SH. Proc Natl Acad Sci U S A. 2004 Sep 7. 101(36):13198-203. 10.1073/pnas.0405202101 PubMed 15331784