p CIneo-RL-Let7-perf
(Plasmid
#115367)
-
PurposeExpression vector to produce humanized Renilla luciferase with a single perfectly complementary binding site for human let-7 miRNA in the 3'UTR
-
Depositing Labs
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 115367 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCIneo
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 5472
-
Vector typeMammalian Expression, Luciferase
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRenilla Luciferase
-
Alt nameLet7 perfect binding site :ACTATACAACCTACTACCTCA
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Xba1 (not destroyed)
- 3′ cloning site Not1 (not destroyed)
- 5′ sequencing primer T3
- 3′ sequencing primer T7 (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
clone number 138
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p CIneo-RL-Let7-perf was a gift from Witold Filipowicz & Ramesh Pillai (Addgene plasmid # 115367 ; http://n2t.net/addgene:115367 ; RRID:Addgene_115367) -
For your References section:
Inhibition of translational initiation by Let-7 MicroRNA in human cells. Pillai RS, Bhattacharyya SN, Artus CG, Zoller T, Cougot N, Basyuk E, Bertrand E, Filipowicz W. Science. 2005 Sep 2. 309(5740):1573-6. 10.1126/science.1115079 PubMed 16081698