pTH825-CEN-minRLuc/slowstaCFLuc
(Plasmid
#115370)
-
PurposeExpresses translation elongation-controlled Renilla luciferase and translation initiation-controlled firefly luciferase
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 115370 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepTH644
- Backbone size w/o insert (bp) 6615
- Total vector size (bp) 9692
-
Vector typeYeast Expression
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameGcn4 5'-UTR + Firefly Luciferase
-
Alt nameCFLuc
-
SpeciesSynthetic; Photinus pyralis
-
Insert Size (bp)2149
-
MutationThe last three codons of the full-length Firefly luciferase gene have been deleted to yield a luciferase variant which is fully functional, but no longer localises to peroxisomes.
-
GenBank IDAF043450
- Promoter TDH3
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (destroyed during cloning)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer GTATATAAAGAACGGTAGG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameRenilla luciferase (codon minimised)
-
Alt nameRLuc
-
SpeciesSynthetic; Renilla reniformis
-
Insert Size (bp)942
-
MutationAll codons have been changed for the least favourable codons for yeast expression
-
GenBank IDAF043450.1
- Promoter ADH1
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site XmaI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CCTGCAATTATTAATCTTTTGTTTCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTH825-CEN-minRLuc/slowstaCFLuc was a gift from Tobias von der Haar (Addgene plasmid # 115370 ; http://n2t.net/addgene:115370 ; RRID:Addgene_115370)