YIplac211-vps10-104
(Plasmid
#115426)
-
PurposeGenerate the vps10-104 allele via pop-in pop-out mutagenesis
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 115426 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneYIplac211
- Backbone size w/o insert (bp) 3797
- Total vector size (bp) 7355
-
Vector typeYeast Expression
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namevps10-104
-
Alt nameAN9
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)2649
-
Mutationdomain 1 deletion
- Promoter Endogenous
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site None (unknown if destroyed)
- 5′ sequencing primer GTAAAACGACGGCCAGT
- 3′ sequencing primer CACACAGGAAACAGCTATGACCAT
- (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note sequence is from JK93da yeast strain rather than S288C
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
YIplac211-vps10-104 was a gift from Benjamin Glick (Addgene plasmid # 115426 ; http://n2t.net/addgene:115426 ; RRID:Addgene_115426) -
For your References section:
Maturation-driven transport and AP-1-dependent recycling of a secretory cargo in the Golgi. Casler JC, Papanikou E, Barrero JJ, Glick BS. J Cell Biol. 2019 May 6;218(5):1582-1601. doi: 10.1083/jcb.201807195. Epub 2019 Mar 11. 10.1083/jcb.201807195 PubMed 30858194