pXPR_BRD003-sgRBFOX1-2098
(Plasmid
#115452)
-
PurposeConstitutive lentiviral expression
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 115452 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepXPR_BRD003
-
Backbone manufacturerBroad Institute - Genetic Perturbation Platform
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRBFOX1-2098
-
gRNA/shRNA sequenceAAGTATATACAAGTGAACTG
-
SpeciesH. sapiens (human)
-
Entrez GeneRBFOX1 (a.k.a. 2BP1, A2BP1, FOX-1, FOX1, HRNBP1)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer LKO.1 5'
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pXPR_BRD003-sgRBFOX1-2098 was a gift from William Hahn (Addgene plasmid # 115452 ; http://n2t.net/addgene:115452 ; RRID:Addgene_115452) -
For your References section:
An alternative splicing switch in FLNB promotes the mesenchymal cell state in human breast cancer. Li J, Choi PS, Chaffer CL, Labella K, Hwang JH, Giacomelli AO, Kim JW, Ilic N, Doench JG, Ly SH, Dai C, Hagel K, Hong AL, Gjoerup O, Goel S, Ge JY, Root DE, Zhao JJ, Brooks AN, Weinberg RA, Hahn WC. Elife. 2018 Jul 30;7. pii: 37184. doi: 10.7554/eLife.37184. 37184 [pii] PubMed 30059005