Spt2-K166R-GFP
(Plasmid
#115573)
-
PurposeExpresses yeast Spt2-GFP fusion protein mutated from lysine to arginine at site 166
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 115573 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepRS316
- Backbone size w/o insert (bp) 4900
- Total vector size (bp) 6600
-
Vector typeBacterial Expression, Yeast Expression
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameSPT2
-
Alt nameSIN1
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)1734
-
MutationLysine 166 mutated to Arginine
-
Tag
/ Fusion Protein
- GFP (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CTTGAGTCCTATTCAAAGTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/345637v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Spt2-K166R-GFP was a gift from Michael Downey (Addgene plasmid # 115573 ; http://n2t.net/addgene:115573 ; RRID:Addgene_115573) -
For your References section:
A synthetic non-histone substrate to study substrate targeting by the Gcn5 HAT and sirtuin HDACs. Rossl A, Denoncourt A, Lin MS, Downey M. J Biol Chem. 2019 Apr 19;294(16):6227-6239. doi: 10.1074/jbc.RA118.006051. Epub 2019 Feb 25. 10.1074/jbc.RA118.006051 PubMed 30804216