pAav-TP53-T2A-BirA*
(Plasmid
#115652)
-
PurposerAAV-based donor template for genome engineering of the TP53 protein C-terminus containing a T2A-BirA* module and a selection cassette
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 115652 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAav
-
Backbone manufacturerAgilent technologies
- Backbone size w/o insert (bp) 2907
- Total vector size (bp) 7416
-
Vector typeAAV
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameTP53
-
SpeciesH. sapiens (human)
-
Insert Size (bp)883
-
MutationHomology region 1
-
Entrez GeneTP53 (a.k.a. BCC7, BMFS5, LFS1, P53, TRP53)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site MluI (not destroyed)
- 3′ cloning site NdeI (not destroyed)
- 5′ sequencing primer CACTAGGGGTTCCTGCGGCCGCAAACGCGTCAGCCCTGCACAGACATTTT
- 3′ sequencing primer TAGGGCGCGATAACTTCGTA
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameTP53
-
SpeciesH. sapiens (human)
-
Insert Size (bp)838
-
MutationHomology region 2
-
Entrez GeneTP53 (a.k.a. BCC7, BMFS5, LFS1, P53, TRP53)
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer GGGAGGATTGGGAAGACAAT
- 3′ sequencing primer GGGTTCCTGCGGCCGCTTTTGCTAGCAGATCACGCCACTCCACTCC
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameT2A
-
SpeciesSynthetic
-
Insert Size (bp)63
-
Tag
/ Fusion Protein
- T2A
Cloning Information for Gene/Insert 3
- Cloning method Unknown
- 5′ sequencing primer CACTAGGGGTTCCTGCGGCCGCAAACGCGTCAGCCCTGCACAGACATTTT
- 3′ sequencing primer TAGGGCGCGATAACTTCGTA
- (Common Sequencing Primers)
Gene/Insert 4
-
Gene/Insert nameBirA*
-
SpeciesE. coli
-
Tag
/ Fusion Protein
- BirA*
Cloning Information for Gene/Insert 4
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer ACATATTTGCATGGGGTGTG
- 3′ sequencing primer TAGGGCGCGATAACTTCGTA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/427807v2 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAav-TP53-T2A-BirA* was a gift from Sven Eyckerman (Addgene plasmid # 115652 ; http://n2t.net/addgene:115652 ; RRID:Addgene_115652) -
For your References section:
A Well-Controlled BioID Design for Endogenous Bait Proteins. Vandemoortele G, De Sutter D, Moliere A, Pauwels J, Gevaert K, Eyckerman S. J Proteome Res. 2018 Dec 10. doi: 10.1021/acs.jproteome.8b00367. 10.1021/acs.jproteome.8b00367 PubMed 30525648