pCF525-EF1a-Hygro-P2A-AcrVA4-lenti
(Plasmid
#115663)
-
PurposeExpresses AcrVA4 in human cells, contained in a lentiviral vector.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 115663 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCF525 (SIN-LTR lenti)
-
Backbone manufacturerN/A
- Backbone size w/o insert (bp) 8100
- Total vector size (bp) 8817
-
Vector typeMammalian Expression, Bacterial Expression, Lentiviral
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAcrVA4
-
SpeciesMoraxella bovoculi
-
Insert Size (bp)705
-
GenBank IDWP_046699156.1
- Promoter EF-1a promoter
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TGCGACGCAATCGTCCGATCC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCF525-EF1a-Hygro-P2A-AcrVA4-lenti was a gift from Jennifer Doudna (Addgene plasmid # 115663 ; http://n2t.net/addgene:115663 ; RRID:Addgene_115663) -
For your References section:
Systematic discovery of natural CRISPR-Cas12a inhibitors. Watters KE, Fellmann C, Bai HB, Ren SM, Doudna JA. Science. 2018 Oct 12;362(6411):236-239. doi: 10.1126/science.aau5138. Epub 2018 Sep 6. 10.1126/science.aau5138 PubMed 30190307