pcDNA 3.3 HA-hTSPAN12
(Plasmid
#115784)
-
PurposeExpresses human TSPAN12 with N-terminal HA-tag in mammalian cells. Contains multiple silent mutations that introduce restriction sites.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 115784 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.3 TOPO TA
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5407
- Total vector size (bp) 6377
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTSPAN12
-
SpeciesH. sapiens (human)
-
Insert Size (bp)970
-
Mutationmultiple silent mutations introduce restriction sites to enable chimera construction
-
Entrez GeneTSPAN12 (a.k.a. EVR5, NET-2, NET2, TM4SF12)
- Promoter CMV
-
Tag
/ Fusion Protein
- HA (N terminal on insert)
Cloning Information
- Cloning method TOPO Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer CTTCCGTGTTTCAGTTAGC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bygene synthesis
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
N-terminal HA tag has no substantial effect in TOPFlash reporter assays induced with Norrin, compared to untagged control
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA 3.3 HA-hTSPAN12 was a gift from Harald Junge (Addgene plasmid # 115784 ; http://n2t.net/addgene:115784 ; RRID:Addgene_115784) -
For your References section:
TSPAN12 Is a Norrin Co-receptor that Amplifies Frizzled4 Ligand Selectivity and Signaling. Lai MB, Zhang C, Shi J, Johnson V, Khandan L, McVey J, Klymkowsky MW, Chen Z, Junge HJ. Cell Rep. 2017 Jun 27;19(13):2809-2822. doi: 10.1016/j.celrep.2017.06.004. 10.1016/j.celrep.2017.06.004 PubMed 28658627