pLV.CMV.GFPmiR125sponge
(Plasmid
#115974)
-
PurposeKnockdown of miR-125
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 115974 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLV
- Backbone size w/o insert (bp) 6394
- Total vector size (bp) 7904
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGFPmiR125sponge
-
SpeciesSynthetic
-
Insert Size (bp)1520
- Promoter CMV
-
Tag
/ Fusion Protein
- GFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer cctgtgttgccacctggatt (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Addgene Notes
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV.CMV.GFPmiR125sponge was a gift from Johan Jakobsson (Addgene plasmid # 115974 ; http://n2t.net/addgene:115974 ; RRID:Addgene_115974) -
For your References section:
microRNA-125 distinguishes developmentally generated and adult-born olfactory bulb interneurons. Akerblom M, Petri R, Sachdeva R, Klussendorf T, Mattsson B, Gentner B, Jakobsson J. Development. 2014 Apr;141(7):1580-8. doi: 10.1242/dev.101659. Epub 2014 Mar 5. 10.1242/dev.101659 PubMed 24598163