pAcUW51-gE2
(Plasmid
#11621)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 11621 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepAcUW51
-
Backbone manufacturerBD Biosciences
- Backbone size w/o insert (bp) 5863
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHSV-1 glycoprotein E
-
Alt nameHSV-1 gE
-
SpeciesHerpes simplex virus type I KOS strain
-
Insert Size (bp)1233
-
Mutationdeleted amino acids 391-550
-
Tag
/ Fusion Protein
- His (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CGGACCTTTAATTCAACCCAAC
- 3′ sequencing primer TTGACACCAGACCAACTGGT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAcUW51-gE2 was a gift from Pamela Bjorkman (Addgene plasmid # 11621 ; http://n2t.net/addgene:11621 ; RRID:Addgene_11621) -
For your References section:
pH dependence and stoichiometry of binding to the Fc region of IgG by the herpes simplex virus Fc receptor gE-gI. Sprague ER, Martin WL, Bjorkman PJ. J Biol Chem. 2004 Apr 2. 279(14):14184-93. 10.1074/jbc.M313281200 PubMed 14734541
Map uploaded by the depositor.
