- 
            Purpose3rd generation lentiviral transfer vector. pPRIME cloning plasmid with a tetracycline-responsive promoter (TET) controlling expression of GFP and miR30-based shRNA targeting firefly luciferase
- 
              Depositing Lab
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 11662 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepPRIME-TET-GFP
- Backbone size w/o insert (bp) 8226
- 
              Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
- 
            Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)DH5alpha
- 
            Copy numberLow Copy
Gene/Insert
- 
                Gene/Insert nameFF3
- 
                  Alt namefirefly luciferase hairpin
- 
                    SpeciesFirefly
- 
                  Insert Size (bp)120
- 
    
        Tag
        / Fusion Protein
    - GFP (N terminal on backbone)
 
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer EGFP-C (Common Sequencing Primers)
Resource Information
- 
            Article Citing this Plasmid
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
TET promoter (minimal CMV promoter containing seven upstream Tet-operator sites) transcribes GFP and miR30-based shRNA targeting FF3. The FF3 hairpin can be replaced with any other hairpin by cloning into the EcoR1/Xho1 site.
Please note that the full plasmid sequence shown here is for the empty vector only and does not contain the FF3 targeting sequence (AGCTCCCGTGAATTGGAATCCTAGTGAAGCCACAGATGTAGGATTCCAATTCAGCGGGAGCC)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: pPRIME-TET-GFP-FF3 was a gift from Stephen Elledge (Addgene plasmid # 11662 ; http://n2t.net/addgene:11662 ; RRID:Addgene_11662)
- 
                For your References section: A lentiviral microRNA-based system for single-copy polymerase II-regulated RNA interference in mammalian cells. Stegmeier F, Hu G, Rickles RJ, Hannon GJ, Elledge SJ. Proc Natl Acad Sci U S A. 2005 Sep 13. 102(37):13212-7. 10.1073/pnas.0506306102 PubMed 16141338
 
    
 
                         
             
            