Skip to main content

pPRIME-CMV-Neo-FF3
(Plasmid #11665)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 11665 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pPRIME-CMV-Neo
  • Backbone size w/o insert (bp) 8595
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    FF3
  • Alt name
    firefly luciferase hairpin
  • Species
    Firefly
  • Insert Size (bp)
    120
  • Tag / Fusion Protein
    • Neo (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer na
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

CMV promoter transcribes Neo and miR30-based shRNA targeting FF3. The FF3 hairpin can be replaced with any other hairpin by cloning into the EcoR1/Xho1 site.

Please note that the full plasmid sequence shown here is for the empty vector only and does not contain the FF3 targeting sequence (AGCTCCCGTGAATTGGAATCCTAGTGAAGCCACAGATGTAGGATTCCAATTCAGCGGGAGCC)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPRIME-CMV-Neo-FF3 was a gift from Stephen Elledge (Addgene plasmid # 11665 ; http://n2t.net/addgene:11665 ; RRID:Addgene_11665)
  • For your References section:

    A lentiviral microRNA-based system for single-copy polymerase II-regulated RNA interference in mammalian cells. Stegmeier F, Hu G, Rickles RJ, Hannon GJ, Elledge SJ. Proc Natl Acad Sci U S A. 2005 Sep 13. 102(37):13212-7. 10.1073/pnas.0506306102 PubMed 16141338