Skip to main content
Addgene

pSB1A3-AD010
(Plasmid #116851)

Ordering

This material is available to academics and nonprofits only. Currently unavailable outside the U.S.
Item Catalog # Description Quantity Price (USD)
Plasmid 116851 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSB1A2
  • Backbone size w/o insert (bp) 2147
  • Total vector size (bp) 5325
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    AraC
  • Species
    Escherichia coli
  • Insert Size (bp)
    984

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer VF tgccacctgacgtctaagaa
  • 3′ sequencing primer p-AD006_2_rev ggttatatctccttctagaggatccccg
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    alpha-HL
  • Alt name
    alpha-hemolysin
  • Species
    Staphylococcus aureus
  • Insert Size (bp)
    1248
  • Promoter pBAD

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer p-AD001_3_fwd AGACGAAAAACTACTAGATGG
  • 3′ sequencing primer p-AD009_2_rev TTAGTTGGTCATTTCTTCTTTTTCCC
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    mScarletI
  • Species
    Synthetic
  • Insert Size (bp)
    882
  • Promoter pBAD

Cloning Information for Gene/Insert 3

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer p-AD006_1_fwd AGCGCTCAACGGGTGTGC
  • 3′ sequencing primer VR attaccgcctttgagtgagc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that pSB1A2 was used to create the plasmid rather than pSB1A3. This does not affect function as described in the associated publication.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSB1A3-AD010 was a gift from Friedrich Simmel (Addgene plasmid # 116851 ; http://n2t.net/addgene:116851 ; RRID:Addgene_116851)
  • For your References section:

    Signalling and differentiation in emulsion-based multi-compartmentalized in vitro gene circuits. Dupin A, Simmel FC. Nat Chem. 2018 Nov 26. pii: 10.1038/s41557-018-0174-9. doi: 10.1038/s41557-018-0174-9. 10.1038/s41557-018-0174-9 PubMed 30478365