pSB1A3-AD010
(Plasmid
#116851)
-
PurposeExpresses araC constitutively. Expresses alpha-hemolysin and mScarletI (RFP) under a pBAD promoter; alternate name pSB1A2-AD010
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 116851 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSB1A2
- Backbone size w/o insert (bp) 2147
- Total vector size (bp) 5325
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameAraC
-
SpeciesEscherichia coli
-
Insert Size (bp)984
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer VF tgccacctgacgtctaagaa
- 3′ sequencing primer p-AD006_2_rev ggttatatctccttctagaggatccccg
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namealpha-HL
-
Alt namealpha-hemolysin
-
SpeciesStaphylococcus aureus
-
Insert Size (bp)1248
- Promoter pBAD
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer p-AD001_3_fwd AGACGAAAAACTACTAGATGG
- 3′ sequencing primer p-AD009_2_rev TTAGTTGGTCATTTCTTCTTTTTCCC
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert namemScarletI
-
SpeciesSynthetic
-
Insert Size (bp)882
- Promoter pBAD
Cloning Information for Gene/Insert 3
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer p-AD006_1_fwd AGCGCTCAACGGGTGTGC
- 3′ sequencing primer VR attaccgcctttgagtgagc
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that pSB1A2 was used to create the plasmid rather than pSB1A3. This does not affect function as described in the associated publication.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSB1A3-AD010 was a gift from Friedrich Simmel (Addgene plasmid # 116851 ; http://n2t.net/addgene:116851 ; RRID:Addgene_116851) -
For your References section:
Signalling and differentiation in emulsion-based multi-compartmentalized in vitro gene circuits. Dupin A, Simmel FC. Nat Chem. 2018 Nov 26. pii: 10.1038/s41557-018-0174-9. doi: 10.1038/s41557-018-0174-9. 10.1038/s41557-018-0174-9 PubMed 30478365