-
PurposeTet-inducible suppression of KRAS
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 116871 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneTet-pLKO-puro
-
Backbone manufacturerDmitri Wiederschain
- Backbone size w/o insert (bp) 10633
- Total vector size (bp) 8758
-
Modifications to backboneshRNA cloned in between AgeI and EcoRI
-
Vector typeMammalian Expression, Lentiviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameshKRAS
-
gRNA/shRNA sequenceCAGTTGAGACCTTCTAATTGG
-
SpeciesH. sapiens (human)
-
GenBank ID3845
-
Entrez GeneKRAS (a.k.a. 'C-K-RAS, C-K-RAS, CFC2, K-RAS2A, K-RAS2B, K-RAS4A, K-RAS4B, K-Ras, K-Ras 2, KI-RAS, KRAS1, KRAS2, NS, NS3, OES, RALD, RASK2, c-Ki-ras, c-Ki-ras2)
- Promoter H1/TO
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (destroyed during cloning)
- 3′ cloning site EcoRI (destroyed during cloning)
- 5′ sequencing primer GGCAGGGATATTCACCATTATCGTTTCAGA
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Tet-pLKO-puro shKRAS was a gift from William Hahn (Addgene plasmid # 116871 ; http://n2t.net/addgene:116871 ; RRID:Addgene_116871) -
For your References section:
KRAS and YAP1 Converge to Regulate EMT and Tumor Survival. Shao DD, Xue W, Krall EB, Bhutkar A, Piccioni F, Wang X, Schinzel AC, Sood S, Rosenbluh J, Kim JW, Zwang Y, Roberts TM, Root DE, Jacks T, Hahn WC. Cell. 2014 Jul 3;158(1):171-84. doi: 10.1016/j.cell.2014.06.004. Epub 2014 Jun 19. 10.1016/j.cell.2014.06.004 PubMed 24954536