pNIA-CEN-FLAG-LINXa4(RVH)-Bre1
(Plasmid
#116885)
-
PurposeFLAG-tagged LINXa4-Bre1 with RVH hinge-loop mutations
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 116885 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepNIA-CEN
- Backbone size w/o insert (bp) 8084
- Total vector size (bp) 10700
-
Vector typeYeast Expression, Synthetic Biology
-
Selectable markersLEU2
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLINXa4(RVH)-Bre1
-
SpeciesS. cerevisiae (budding yeast), Synthetic; Avena sativa
-
MutationBre1 point mutations K8A, K9A and K11A, LINXa3 wild type HVR 519-521 to RVH
- Promoter ADH1
-
Tag
/ Fusion Protein
- FLAG (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer GTCATTGTTCTCGTTCCCTTTCTTCCTTG
- 3′ sequencing primer GGGACCTAGACTTCAGGTTGTCTAACTCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNIA-CEN-FLAG-LINXa4(RVH)-Bre1 was a gift from Brian Kuhlman (Addgene plasmid # 116885 ; http://n2t.net/addgene:116885 ; RRID:Addgene_116885) -
For your References section:
Engineering Improved Photoswitches for the Control of Nucleocytoplasmic Distribution. Lerner AM, Yumerefendi H, Goudy OJ, Strahl BD, Kuhlman B. ACS Synth Biol. 2018 Nov 29. doi: 10.1021/acssynbio.8b00368. 10.1021/acssynbio.8b00368 PubMed 30441907