Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pCMV-PfV-Sapphire-IRES-DSRed
(Plasmid #116934)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 116934 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLVX
  • Backbone size w/o insert (bp) 9672
  • Total vector size (bp) 10707
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Pfv
  • Species
    Pyrococcus furiosus
  • Insert Size (bp)
    1035
  • GenBank ID
    AB214633.1
  • Promoter CMV
  • Tag / Fusion Protein
    • Sapphire (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TCCGCCCCATTGACGCAAAT
  • 3′ sequencing primer gccttattccaagcggctt
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV-PfV-Sapphire-IRES-DSRed was a gift from Liam Holt (Addgene plasmid # 116934 ; http://n2t.net/addgene:116934 ; RRID:Addgene_116934)
  • For your References section:

    mTORC1 Controls Phase Separation and the Biophysical Properties of the Cytoplasm by Tuning Crowding. Delarue M, Brittingham GP, Pfeffer S, Surovtsev IV, Pinglay S, Kennedy KJ, Schaffer M, Gutierrez JI, Sang D, Poterewicz G, Chung JK, Plitzko JM, Groves JT, Jacobs-Wagner C, Engel BD, Holt LJ. Cell. 2018 Jul 12;174(2):338-349.e20. doi: 10.1016/j.cell.2018.05.042. Epub 2018 Jun 21. 10.1016/j.cell.2018.05.042 PubMed 29937223