pT7-HISx6-SIMx6
(Plasmid
#116938)
-
PurposeBacterial expression vector for 6 sim
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 116938 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepet28a
- Total vector size (bp) 6842
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert name6 sim
- Promoter T7
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer T7
- 3′ sequencing primer AACTCAGCTTCCTTTCGGGCTTTG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pT7-HISx6-SIMx6 was a gift from Liam Holt (Addgene plasmid # 116938 ; http://n2t.net/addgene:116938 ; RRID:Addgene_116938) -
For your References section:
mTORC1 Controls Phase Separation and the Biophysical Properties of the Cytoplasm by Tuning Crowding. Delarue M, Brittingham GP, Pfeffer S, Surovtsev IV, Pinglay S, Kennedy KJ, Schaffer M, Gutierrez JI, Sang D, Poterewicz G, Chung JK, Plitzko JM, Groves JT, Jacobs-Wagner C, Engel BD, Holt LJ. Cell. 2018 Jul 12;174(2):338-349.e20. doi: 10.1016/j.cell.2018.05.042. Epub 2018 Jun 21. 10.1016/j.cell.2018.05.042 PubMed 29937223