Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pSM-GFPnovo2
(Plasmid #116943)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 116943 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSM
  • Backbone manufacturer
    Cori Bargmann's lab
  • Backbone size w/o insert (bp) 3600
  • Total vector size (bp) 4469
  • Vector type
    Worm Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    C. elegans codon optimized GFPnovo2
  • Species
    Synthetic
  • Insert Size (bp)
    870
  • Mutation
    Y145F, V163A, S202T, L221V
  • GenBank ID
    8382257
  • Promoter none
  • Tag / Fusion Protein
    • GFPnovo2

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer atgaccatgattacgccaa
  • 3′ sequencing primer ttggacttagaagtcagagg
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    This plasmid was generated by introducing mutations in the pSM (eGFP_unc-54 utr) plasmid which is a kind gift from Dr. Cori Bargmann.

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that some discrepancies were found between Addgene's quality control and the depositor's full plasmid sequence. The depositor noted that the backbone was not sequenced, and these discrepancies do NOT affect plasmid function.

GFPnovo2 was originally generated by Arakawa et al., (2008)

Arakawa, H., Kudo, H., Batrak, V., Caldwell, R. B., Rieger, M. A., Ellwart, J. W., & Buerstedde, J.-M. (2008). Protein evolution by hypermutation and selection in the B cell line DT40. Nucleic Acids Research, 36(1), e1. http://doi.org/10.1093/nar/gkm616

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSM-GFPnovo2 was a gift from Kota Mizumoto (Addgene plasmid # 116943 ; http://n2t.net/addgene:116943 ; RRID:Addgene_116943)
  • For your References section:

    GFPnovo2, a brighter GFP variant for in vivo labeling in C. elegans. Hendi A, Mizumoto K.. microPublication Biology (2018) 10.17912/49YB-7K39