Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We have implemented updates to our Transparency and Privacy Policy.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #117075)


Item Catalog # Description Quantity Price (USD)
Plasmid 117075 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
    pDONR 207
  • Backbone manufacturer
    Invitrogen - thermo fisher
  • Backbone size w/o insert (bp) 3350
  • Total vector size (bp) 4600
  • Vector type
    Gateway Cloning system

Growth in Bacteria

  • Bacterial Resistance(s)
    Gentamycin, 10 μg/mL
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    When subcloning into expression vectors, recombination might occur. We recommend growing all subcloning products in STBL2 cells at 30ºC
  • Copy number
    Low Copy


  • Gene/Insert name
  • Alt name
    Blue Light Induced K+ channel 2
  • Species
    A. sativa, Chlorella virus, A.thaliana
  • Insert Size (bp)
  • Mutation
    glutamine 112 changed into aspartate (original LOV domain numbering Q513D)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer TCGCGTTAACGCTAGCATGGATCTC
  • 3′ sequencing primer GTAACATCAGAGATTTTGAGACAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDONR-BLINK2 was a gift from Anna Moroni (Addgene plasmid # 117075 ; ; RRID:Addgene_117075)
  • For your References section:

    A light-gated potassium channel for sustained neuronal inhibition. Alberio L, Locarno A, Saponaro A, Romano E, Bercier V, Albadri S, Simeoni F, Moleri S, Pelucchi S, Porro A, Marcello E, Barsotti N, Kukovetz K, Boender AJ, Contestabile A, Luo S, Moutal A, Ji Y, Romani G, Beltrame M, Del Bene F, Di Luca M, Khanna R, Colecraft HM, Pasqualetti M, Thiel G, Tonini R, Moroni A. Nat Methods. 2018 Nov;15(11):969-976. doi: 10.1038/s41592-018-0186-9. Epub 2018 Oct 30. 10.1038/s41592-018-0186-9 PubMed 30377377