SLAC1-FL
(Plasmid
#117100)
-
Purposeprotein expression in yeast
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 117100 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepPICZc
-
Vector typeYeast Expression
Growth in Bacteria
-
Bacterial Resistance(s)Bleocin (Zeocin), 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSLAC1-FL
-
Alt name>sp|Q9LD83|SLAC1_ARATH Guard cell S-type anion channel SLAC1 OS=Arabidopsis thaliana OX=3702 GN=SLAC1 PE=1 SV=1
-
SpeciesA. thaliana (mustard weed)
- Promoter AOX
-
Tag
/ Fusion Protein
- His (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GACTGGTTCCAATTGACAAGC
- 3′ sequencing primer GCAAATGGCATTCTGACATCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
SLAC1-FL was a gift from Geoffrey Chang (Addgene plasmid # 117100 ; http://n2t.net/addgene:117100 ; RRID:Addgene_117100)