mTet1 flox donor
(Plasmid
#117147)
-
PurposeMaking Tet1 conditional knock out
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 117147 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepDT
- Backbone size w/o insert (bp) 3000
- Total vector size (bp) 14000
-
Vector typeMouse Targeting
-
Selectable markersNeomycin (select with G418) ; DT
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTet1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)11000
-
Entrez GeneTet1 (a.k.a. 2510010B09Rik, Cxxc6, D10Ertd17e, LCX, mKIAA1676)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GAGTACGTAGTTGTGCACATGTAGT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mTet1 flox donor was a gift from Jacob Hanna (Addgene plasmid # 117147 ; http://n2t.net/addgene:117147 ; RRID:Addgene_117147) -
For your References section:
The Molecular and Functional Foundations of Conducive Somatic Cell Reprogramming to Ground State Pluripotency. Zviran A, Mor N, Rais Y, Gingold H, Peles S, Chomsky E, Viukov S, Buenrostro JD, Scognamiglio R, Weinberger L, Manor YS, Krupalnik V, Zerbib M, Hezroni H, Jaitin AD, Larastiaso D, Gilad S, Benjamin S, Gafni O, Mousa A, Ayyash M, Sheban D, Bayerl J, Aguilera-Castrejon A, Massarwa R, Maza I, Hanna S, Stelzer Y, Ulitsky I, Greenleaf WJ, Tanay A, Trumpp A, Amit I, Pilpel Y, Novershtern N, Hanna JH. ssrn.3155731 10.2139/ssrn.3155731