-
PurposePlasmid name in publication: pAAV-DIO-Matrix-dAPEX2. Peroxidase reporter for multiplexed electron microscopy labeling
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 117177 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 5614
- Total vector size (bp) 6487
-
Vector typeMammalian Expression, AAV, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCOX4-dAPEX2
-
Alt namepAAV-DIO-Matrix-dAPEX2
-
SpeciesG. max (soybean)
-
Insert Size (bp)873
-
MutationW41F and A134P on soybean APX
- Promoter EF1a
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tcaagcctcagacagtggttc
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-DIO-COX4-dAPEX2 was a gift from David Ginty (Addgene plasmid # 117177 ; http://n2t.net/addgene:117177 ; RRID:Addgene_117177) -
For your References section:
Multiplexed peroxidase-based electron microscopy labeling enables simultaneous visualization of multiple cell types. Zhang Q, Lee WA, Paul DL, Ginty DD. Nat Neurosci. 2019 Mar 18. pii: 10.1038/s41593-019-0358-7. doi: 10.1038/s41593-019-0358-7. 10.1038/s41593-019-0358-7 PubMed 30886406