Skip to main content

pAAV-DIO-COX4-dAPEX2
(Plasmid #117177)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 117177 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV
  • Backbone size w/o insert (bp) 5614
  • Total vector size (bp) 6487
  • Vector type
    Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    COX4-dAPEX2
  • Alt name
    pAAV-DIO-Matrix-dAPEX2
  • Species
    G. max (soybean)
  • Insert Size (bp)
    873
  • Mutation
    W41F and A134P on soybean APX
  • Promoter EF1a

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer tcaagcctcagacagtggttc
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-DIO-COX4-dAPEX2 was a gift from David Ginty (Addgene plasmid # 117177 ; http://n2t.net/addgene:117177 ; RRID:Addgene_117177)
  • For your References section:

    Multiplexed peroxidase-based electron microscopy labeling enables simultaneous visualization of multiple cell types. Zhang Q, Lee WA, Paul DL, Ginty DD. Nat Neurosci. 2019 Mar 18. pii: 10.1038/s41593-019-0358-7. doi: 10.1038/s41593-019-0358-7. 10.1038/s41593-019-0358-7 PubMed 30886406