Skip to main content

pAGM22082_cRed
(Plasmid #117225)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 117225 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET28-b
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5325
  • Total vector size (bp) 13411
  • Modifications to backbone
    Introduced mutations for Type IIs cleavage site removal
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Canthaxanthin Operon
  • Species
    Erwinia uredovora, Escherichia Coli, Agrobacterium aurantiacum
  • Insert Size (bp)
    8086
  • Mutation
    removed Type IIS restriction sites within the backbone (BsaI and BbsI)
  • GenBank ID
    D90087.2
  • Promoter T7 RNA Polymerase
  • Tag / Fusion Protein
    • 34 amino acid N-terminal linker, Hexahistidine Tag, T7 Leader Tag (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BstXI (not destroyed)
  • 3′ cloning site BstXI (not destroyed)
  • 5′ sequencing primer GAAGGAGATATACCATGGGCAGCAG
  • 3′ sequencing primer CGTTTAGAGGCCCCAAGGGGTTATG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    canthaxanthin operon as previously described in pAGM4673 (Plasmid #48014)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAGM22082_cRed was a gift from Sylvestre Marillonnet (Addgene plasmid # 117225 ; http://n2t.net/addgene:117225 ; RRID:Addgene_117225)
  • For your References section:

    Golden Mutagenesis: An efficient multi-site-saturation mutagenesis approach by Golden Gate cloning with automated primer design. Pullmann P, Ulpinnis C, Marillonnet S, Gruetzner R, Neumann S, Weissenborn MJ. Sci Rep. 2019 Jul 29;9(1):10932. doi: 10.1038/s41598-019-47376-1. 10.1038/s41598-019-47376-1 PubMed 31358887