Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pcDNA3.1+DPP6
(Plasmid #117272)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 117272 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pcDNA3.1+
  • Backbone manufacturer
    Genescript
  • Backbone size w/o insert (bp) 5400
  • Total vector size (bp) 7982
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    DPP6
  • Alt name
    DPP6
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_130797.3
  • Entrez Gene
    DPP6 (a.k.a. DPL1, DPPX, MRD33, VF2)
  • Promoter CMV

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1+DPP6 was a gift from Mark Cannell (Addgene plasmid # 117272 ; http://n2t.net/addgene:117272 ; RRID:Addgene_117272)
  • For your References section:

    Regulation of Kv4.3 and hERG potassium channels by KChIP2 isoforms and DPP6 and response to the dual K(+) channel activator NS3623. Lainez S, Doray A, Hancox JC, Cannell MB. Biochem Pharmacol. 2018 Apr;150:120-130. doi: 10.1016/j.bcp.2018.01.036. Epub 2018 Jan 31. 10.1016/j.bcp.2018.01.036 PubMed 29378180