PB09-TRE-ZNF787_G379A
(Plasmid
#117320)
-
PurposeOverexpression of ZNF787
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 117320 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonePB-TRE
-
Backbone manufacturerChurch Lab
- Backbone size w/o insert (bp) 7401
-
Vector typeMammalian Expression ; Transposon-mediated integration
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameZNF787
-
Alt nameNM_001002836
-
Alt nameENSG00000142409
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1152
-
MutationG379A
-
Entrez GeneZNF787 (a.k.a. TIP20)
- Promoter Tet-inducible promoter
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ccaactttccgtaccacttcctac
- 3′ sequencing primer ttgtcttcccaatcctcccc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
5' NcoI cloning site destroyed, 3' XhoI cloning site destroyed
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PB09-TRE-ZNF787_G379A was a gift from Volker Busskamp (Addgene plasmid # 117320 ; http://n2t.net/addgene:117320 ; RRID:Addgene_117320) -
For your References section:
Combined Experimental and System-Level Analyses Reveal the Complex Regulatory Network of miR-124 during Human Neurogenesis. Kutsche LK, Gysi DM, Fallmann J, Lenk K, Petri R, Swiersy A, Klapper SD, Pircs K, Khattak S, Stadler PF, Jakobsson J, Nowick K, Busskamp V. Cell Syst. 2018 Sep 28. pii: S2405-4712(18)30358-2. doi: 10.1016/j.cels.2018.08.011. 10.1016/j.cels.2018.08.011 PubMed 30292704