Skip to main content

PB09-TRE-ZNF787_G379A
(Plasmid #117320)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 117320 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 117320-D50 50 μg of DNA in Tris buffer $495
DNA 117320-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    PB-TRE
  • Backbone manufacturer
    Church Lab
  • Backbone size w/o insert (bp) 7401
  • Vector type
    Mammalian Expression ; Transposon-mediated integration
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ZNF787
  • Alt name
    NM_001002836
  • Alt name
    ENSG00000142409
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1152
  • Mutation
    G379A
  • Entrez Gene
    ZNF787 (a.k.a. TIP20)
  • Promoter Tet-inducible promoter

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ccaactttccgtaccacttcctac
  • 3′ sequencing primer ttgtcttcccaatcctcccc
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

5' NcoI cloning site destroyed, 3' XhoI cloning site destroyed

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PB09-TRE-ZNF787_G379A was a gift from Volker Busskamp (Addgene plasmid # 117320 ; http://n2t.net/addgene:117320 ; RRID:Addgene_117320)
  • For your References section:

    Combined Experimental and System-Level Analyses Reveal the Complex Regulatory Network of miR-124 during Human Neurogenesis. Kutsche LK, Gysi DM, Fallmann J, Lenk K, Petri R, Swiersy A, Klapper SD, Pircs K, Khattak S, Stadler PF, Jakobsson J, Nowick K, Busskamp V. Cell Syst. 2018 Sep 28. pii: S2405-4712(18)30358-2. doi: 10.1016/j.cels.2018.08.011. 10.1016/j.cels.2018.08.011 PubMed 30292704