pmiRGLO-PPM1F-201
(Plasmid
#117334)
-
PurposeDual luciferase assay for miRNA-targeted UTR
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 117334 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepmiRGLO
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 7334
-
Vector typeMammalian Expression, Luciferase
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name3' UTR PPM1F-201
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3672
- Promoter Murine PGK-1
-
Tag
/ Fusion Protein
- luciferase (N terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer Fluc-F1 (AGAAGCTGCGCGGTGGTGTTGTG)
- 3′ sequencing primer T7terminal (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
5' NheI cloning site destroyed, 3' XbaI cloning site destroyed
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pmiRGLO-PPM1F-201 was a gift from Volker Busskamp (Addgene plasmid # 117334 ; http://n2t.net/addgene:117334 ; RRID:Addgene_117334) -
For your References section:
Combined Experimental and System-Level Analyses Reveal the Complex Regulatory Network of miR-124 during Human Neurogenesis. Kutsche LK, Gysi DM, Fallmann J, Lenk K, Petri R, Swiersy A, Klapper SD, Pircs K, Khattak S, Stadler PF, Jakobsson J, Nowick K, Busskamp V. Cell Syst. 2018 Sep 28. pii: S2405-4712(18)30358-2. doi: 10.1016/j.cels.2018.08.011. 10.1016/j.cels.2018.08.011 PubMed 30292704