Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pTn7xTS-mPlum
(Plasmid #117392)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 117392 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pUC18R6K
  • Modifications to backbone
    The temperature-sensitive origin of replication ori101/repA101ts was inserted via blunt-ligation into the R6K origin of replication, rendering the R6K ori dysfunctional.
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    30°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Also carries a gentamicin selectable marker
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    mPlum
  • Species
    Synthetic
  • Insert Size (bp)
    1150
  • Promoter Ptac

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SmaI (destroyed during cloning)
  • 3′ cloning site SmaI (destroyed during cloning)
  • 5′ sequencing primer caaagggaatcaggggatct
  • 3′ sequencing primer gaggggtggaaatggagttt
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTn7xTS-mPlum was a gift from Karen Guillemin (Addgene plasmid # 117392 ; http://n2t.net/addgene:117392 ; RRID:Addgene_117392)
  • For your References section:

    Modernized Tools for Streamlined Genetic Manipulation and Comparative Study of Wild and Diverse Proteobacterial Lineages. Wiles TJ, Wall ES, Schlomann BH, Hay EA, Parthasarathy R, Guillemin K. MBio. 2018 Oct 9;9(5). pii: mBio.01877-18. doi: 10.1128/mBio.01877-18. 10.1128/mBio.01877-18 PubMed 30301859