-
PurposeExpresses TMEM41B tagged with 3xFLAG in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 117415 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMRXIP
-
Backbone manufacturerDr.Shoji Yamaoka of Tokyo Medical and Dental University
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTMEM41B
-
SpeciesH. sapiens (human)
-
Entrez GeneTMEM41B
-
Tag
/ Fusion Protein
- 3xFLAG (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site BamHI (unknown if destroyed)
- 5′ sequencing primer GGCATCGCAGCTTGGATACACGCC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byIt has the pMX backbone
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMRXIP TMEM41B-3xFLAG was a gift from Noboru Mizushima (Addgene plasmid # 117415 ; http://n2t.net/addgene:117415 ; RRID:Addgene_117415) -
For your References section:
Genome-wide CRISPR screen identifies TMEM41B as a gene required for autophagosome formation. Morita K, Hama Y, Izume T, Tamura N, Ueno T, Yamashita Y, Sakamaki Y, Mimura K, Morishita H, Shihoya W, Nureki O, Mano H, Mizushima N. J Cell Biol. 2018 Aug 9. pii: jcb.201804132. doi: 10.1083/jcb.201804132. 10.1083/jcb.201804132 PubMed 30093494