Fly 2.0 pIDTBlue
(Plasmid
#117418)
-
PurposeDrosophila melanogaster gene cloned into pIDTBlue vector for internal extraction control
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 117418 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepIDTBlue
-
Backbone manufacturerIntegrated DNA Technologies
- Backbone size w/o insert (bp) 3000
- Total vector size (bp) 3005
-
Modifications to backbonepIDTBlue Ampicillin 5’ to T7 promoter
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameFLY 2.0
-
Alt nameFLY 2.0
-
SpeciesD. melanogaster (fly)
-
Insert Size (bp)75
-
Tag
/ Fusion Protein
- NA
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer AGCGTTTTAAGCTCCAACGA
- 3′ sequencing primer GTCCACTTGGGAGTCAGGAA (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Fly 2.0 pIDTBlue was a gift from Dirk Dittmer (Addgene plasmid # 117418 ; http://n2t.net/addgene:117418 ; RRID:Addgene_117418)