pICSL12021
(Plasmid
#117511)
-
PurposeAtICU2 promoter Golden Gate Level 0
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 117511 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepICH41295
- Backbone size w/o insert (bp) 2247
- Total vector size (bp) 2875
-
Vector typePlant Expression
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameBsaI:GGAG:pICU2:AATG:BsaI
-
SpeciesA. thaliana (mustard weed)
-
Insert Size (bp)628
-
GenBank IDAT5G67100
- Promoter AtICU2
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (not destroyed)
- 3′ cloning site BsaI (not destroyed)
- 5′ sequencing primer CGTTATCCCCTGATTCTGTGGATAAC
- 3′ sequencing primer GTCTCATGAGCGGATACATATTTGAATG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Cloned by Laurence Tomlinson . Please visit https://www.biorxiv.org/content/early/2018/09/17/419952 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pICSL12021 was a gift from Jonathan D Jones (Addgene plasmid # 117511 ; http://n2t.net/addgene:117511 ; RRID:Addgene_117511) -
For your References section:
Optimization of T-DNA architecture for Cas9-mediated mutagenesis in Arabidopsis. Castel B, Tomlinson L, Locci F, Yang Y, Jones JDG. PLoS One. 2019 Jan 9;14(1):e0204778. doi: 10.1371/journal.pone.0204778. eCollection 2019. 10.1371/journal.pone.0204778 PubMed 30625150