Kif1A(1-489)-DHFR-myc
(Plasmid
#117833)
-
PurposeConstitutively active Kinesin-3 motor tagged with DHFR and myc
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 117833 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepcDNA3.1(+)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKif1A (1-489)
-
Alt nameKinesin-3 motor domain
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1467
-
Mutationonly aa 1-489 (motor domain)
-
GenBank IDXP_006529221.1
-
Entrez GeneKif1a (a.k.a. A, ATSV, C630002N23Rik, Gm1626, Kn, Kns1)
- Promoter CMV
-
Tags
/ Fusion Proteins
- DHFR (C terminal on insert)
- myc (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CMV_fwd (CGCAAATGGGCGGTAGGCGTG)
- 3′ sequencing primer BGH_rev (TAGAAGGCACAGTCGAGG) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Addgene NGS results found S33N and E170G variants in Kif1A compared to the NCBI reference [XP_006529221.1]. These variants do not affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Kif1A(1-489)-DHFR-myc was a gift from Thomas Schwarz (Addgene plasmid # 117833 ; http://n2t.net/addgene:117833 ; RRID:Addgene_117833) -
For your References section:
The light-sensitive dimerizer zapalog reveals distinct modes of immobilization for axonal mitochondria. Gutnick A, Banghart MR, West ER, Schwarz TL. Nat Cell Biol. 2019 Jun;21(6):768-777. doi: 10.1038/s41556-019-0317-2. Epub 2019 May 6. 10.1038/s41556-019-0317-2 PubMed 31061466