Skip to main content

CIPK2-uPIC
(Plasmid #117862)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 117862 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pPICZc
  • Backbone size w/o insert (bp) 3329
  • Vector type
    Yeast Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Bleocin (Zeocin), 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CIPK2-uPIC
  • Species
    A. thaliana (mustard weed)
  • Entrez Gene
    CIPK2 (a.k.a. AT5G07070, CBL-INTERACTING PROTEIN KINASE 2, CBL-interacting protein kinase 2, SNF1-RELATED PROTEIN KINASE 3.2, SnRK3.2, T28J14.10, T28J14_10)
  • Promoter AOX

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer GACTGGTTCCAATTGACAAGC
  • 3′ sequencing primer GCAAATGGCATTCTGACATCC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

insert amino acid sequence: MENKPSVLTERYEVGRLLGQGTFAKVYFGRSNHTNESVAIKMIDKDKVMRVGLSQQIKREISVMRIAKHPNVVELYEVMATKSRIYFVIEYCKGGELFNKVAKGKLKEDVAWKYFYQLISAVDFCHSRGVYHRDIKPENLLLDDNDNLKVSDFGLSALADCKRQDGLLHTTCGTPAYVAPEVINRKGYEGTKADIWSCGVVLFVLLAGYLPFHDTNLMEMYRKIGKADFKCPSWFAPEVKRLLCKMLDPNHETRITIAKIKESSWFRKGLHLKQKKMEKMEKQQVREATNPMEAGGSGQNENGENHEPPRLATLNAFDIIALSTGFGLAGLFGDVYDKRESRFASQKPASEIISKLVEVAKCLKLKIRKQGAGLFKLERVKEGKNGILTMDAEIFQVTPTFHLVEVKKCNGDTMEYQKLVEEDLRPALADIVWVWQGEKEKEEQLLQDEQGEQEPS

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CIPK2-uPIC was a gift from Geoffrey Chang (Addgene plasmid # 117862 ; http://n2t.net/addgene:117862 ; RRID:Addgene_117862)